Skip to Content
Merck

EMU065631

MISSION® esiRNA

targeting mouse Foxa1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting mouse Foxa1

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGCTTCGGAGTTGAAGTCTCCAGCGTCTTCATCTGCGCCCCCCATAAGCTCCGGGCCAGGGGCGCTGGCATCTGTACCCCCCTCTCACCCGGCTCACGGCCTGGCACCCCACGAATCTCAGCTGCATCTGAAAGGGGATCCCCGCTACTCCTTTAATCACCCCTTCTCCATCAACAACCTCATGTCCTCCTCCGAGCAACAGCACAAGCTGGACTTCAAGGCATACGAGCAGGCGCTGCAGTACTCTCCTTATGGCGCTACCTTGCCCGCCAGTCTGCCCCTTGGCAGCGCCTCAGTGGCCACGAGGAGCCCCATCGAGCCCTCAGCCCTGGAGCCAGCCTACTACCAAGGTGTGTATTCCAGACCCGTGCTAAATACTTCCTAGCTCCCAGAACTGAGGGTTTTGTCTGCATG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wenhuan Guo et al.
The Prostate, 75(9), 976-987 (2015-03-27)
ELL-associated factor 2 (EAF2) is an androgen-regulated tumor suppressor in the prostate. However, the mechanisms underlying tumor suppressive function of EAF2 are still largely unknown. Identification of factors capable of modulating EAF2 function will help elucidate the mechanisms underlying EAF2
Tuanhui Chen et al.
Experimental cell research, 326(2), 326-335 (2014-05-08)
Transcription factor Foxa1 plays a critical role during neural differentiation and is induced immediately after retinoic acid (RA)-initiated differentiation of pluripotent P19 embryonal carcinoma cells, correlated with the downregulated expression of pluripotency-related genes such as Nanog. To study whether Foxa1

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service