Select a Size
About This Item
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGCCACCACTATTTCCACAAGCCCTGCGTGTCCATCTGGCTTCAGAAGTCTGGCACCTGCCCAGTGTGCCGCTGCATGTTCCCTCCCCCGCTCTAAAAGCCAAGGCTCGTCGTAACAGTCAGCCTGGTTACATTCCCTGTCCGAAACCCACAATACTACAGGAGCCCTTGTTCTAAACTTACAATGAAACCAGTCAGTCAATTAGACTAAAGTTGTTGATTCCTTGTGATTATTTCCATGTGAAAATGGTTGTGTACAATGACATTTAAAAAAAATCATCCTCTCGTTTAGAAGGTAGAAAGGGGGAAAGGAAACTTTCTAAATGCTGCTTGAGATTGCAGTAAGAACATACATTTTCTAACCTGAAAGTTGAAACAAATCCCACTTGTTCTGTAGACTGTGTCTCTCTTACCTGTTGCTGTCAGGGTTACCTATCTGCTAAACTATGTCGGAAAGACAAAATTACTTTTGTTGCATGTCATGGGTTAATGTTCCTGTATTTGCAGTGGTG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... PJA1(18744), Pja1(18744)
Related Categories
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Listings
Regulatory Listings are mainly provided for chemical products. Only limited information can be provided here for non-chemical products. No entry means none of the components are listed. It is the user’s obligation to ensure the safe and legal use of the product.
EMU160661-50UG: + EMU160661-20UG:
jan
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU160661-50UG | 04061828736973 |
| EMU160661-20UG | 04061828788187 |
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service