Coronavirus COVID-19 (SARS-CoV-2) Detection, Characterization & Vaccine Production



 Expediting Your COVID-19 Response & Vaccine Research

As a global life science supplier, we are here to help in the response to COVID-19. From supplying raw materials and research products for detection and characterization to production, we’ve consolidated relevant product and service offerings within a single page.

Current events around the spread of COVID-19 and its impact on public health continue to evolve. During this extraordinary time, we are committed to providing researchers, developers and manufacturers with the necessary products and services to aid the COVID-19 response. As such, our top priorities remain the safety and well-being of our employees, meeting the needs of our customers, providing accurate, timely, information, and ensuring business continuity.

We have mobilized a global task force to actively evaluate the overall supply chain of both our products and key raw material suppliers to mitigate any potential disruption. Leveraging business continuity plans, we remain dedicated to supplying our customers in all markets and providing assistance to the scientific effort occurring around the world, with products and services both supporting the detection of COVID-19 and the development of therapies.

This page will continue to be updated with new products and information.
 

 Virus Detection

We are committed to providing researchers with the reagents and technical expertise for timely support of the SARS-CoV-2 outbreak. Explore our offering across viral RNA purification, RT-PCR, RT-qPCR, Immunoassay, and supporting reagents that are suitable for SARS-CoV-2 diagnostics assay development.

See a comprehensive overview of our solutions for Immunoassay and Molecular Dx assay development.
 

 2019-nCoV Coronavirus qPCR Assay Designs and Reagents

Our 2019-nCoV (SARS-CoV-2) qPCR assay designs (see below) are available for immediate ordering from our KiCqStart® product lines.

The following target detection designs are available for open use (currently in silico validated only):
 

Detection Chemistry Forward Reverse Probe
SYBR Green 1 GCCTCTTCTCGTTCCTCATCAC AGCAGCATCACCGCCATTG  
SYBR Green 2 AGCCTCTTCTCGTTCCTCATCAC CCGCCATTGCCAGCCATTC  
Dual-Labeled Probe 1  CCGCAAGGTTCTTCTTCGTAAG TGCTATGTTTAGTGTTCCAGTTTTC AAGGATCAGTGCCAAGCTCGTCGCC
Dual-Labeled Probe 2 GGCTTACCGCAAGGTTCTTC TGCTATGTTTAGTGTTCCAGTTTTC AAGGATCAGTGCCAAGCTCGTCGCC
Dual-Labeled Probe 3 CAGGTATATGCGCTAGTTATCAGAC CCAAGTGACATAGTGTAGGCAATG AGACTAATTCTCCTCGGCGGGCACG
Dual-Labeled Probe 4 GCAGGTATATGCGCTAGTTATCAG ACACTGGTAGAATTTCTGTGGTAAC AGACTAATTCTCCTCGGCGGGCACG


The following SARS positive control assay is available for open use (currently in silico validated only):
 

Detection Chemistry Forward Reverse Probe
Dual-Labeled Probe GCTGTGTGTTTGCCTATGTTGG ACGTTCACGACTCAGTATCTCAAG AGCGTGCCTACTGGGTTCCTCGTGC

 RT-PCR, RT-qPCR Molecular Analysis and Supporting Reagents

We offer a wide variety of PCR reagents, kits and tools to meet your experimental needs at any stage of SARS-CoV-2 assay development. Our products vary from routine to enhanced, so that you find the level of fidelity, speed, and accuracy you need for every PCR assay.

  • Transcriptor One-Step RT-PCR Kit
    Utilizing hot start one-step RT-PCR technology, Transcriptor One-Step RT-PCR Kit includes a mixture of enzymes, including Taq DNA polymerase and a proofreading polymerase, to ensure sensitive and robust reverse transcription. Except for template and primers, Transcriptor One-Step RT-PCR Kit provides all the components required for one-step RT-PCR.
  • KAPA PROBE FAST One-Step
    KAPA PROBE FAST One-Step is designed for high-throughput, fast-cycling, one-step RNA quantification. KAPA PROBE FAST One-Step is suitable for use with all fluorogenic probe-based technologies, including hybridization probes (e.g., FRET), hydrolysis probes (e.g., TaqMan®) and displacement probes (e.g., molecular beacons).
  • Titan™ One Tube RT-PCR System
    Incorporating a mixture of three enzymes, Titan™ One Tube RT-PCR System utilizes reverse transcriptase AMV for first-strand cDNA synthesis and the Expand™ High Fidelity enzyme blend, consisting of Taq DNA polymerase and a polymerase with a proofreading activity, for amplification of cDNA by PCR.
  • Quantitative RT-PCR ReadyMix™
    In addition to containing Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) for first-strand cDNA synthesis, the Quantitative RT-PCR ReadyMix™ is conveniently blended with JumpStart Taq DNA polymerase, 99% pure deoxynucleotides, buffer, stabilizers, and ships as a 2x concentrate.
  • KiCqStart® One-Step Probe RT-qPCR ReadyMix™
    Suitable for all dual-labeled probe chemistries, KiCqStart® One-Step Probe RT-qPCR ReadyMix™ comes with all required components for RT-qPCR, except for RNA template and probe. KiCqStart® One-Step Probe RT-qPCR ReadyMix™ is available with or without ROX™ reference dye.
  • GenElute™ Total RNA Purification Kit
    Providing a rapid method for the isolation and purification of RNA from a variety of sample types, including viral RNA from cells, tissues, blood, and swabs, these kits are available in both miniprep and maxiprep size spin columns for fast processing.
  • SYBR® Green Quantitative RT-qPCR
    Providing a highly sensitive method for the quantitative analysis of gene expression, this kit combines the advantages of Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) and JumpStart Taq in a convenient ReadyMix.

For Research Use Only. Not for use in diagnostic procedures.
 

 Ultrapure Water

With rapidly evolving and diverse research projects, changing priorities, multiple users and limited space, it’s critical for laboratories to select equipment that is versatile, innovative and flexible to their space requirements. Our Milli-Q® IQ 7000 ultrapure water system and its application filters tick all these boxes.
 

 Essential Products for Molecular Dx & Immunoassay Development

Antibodies for Serology Assay Development
Antibody product range to subclass human immunoglobulins (IgG, IgM, IgA) that have shown reactivity to SARS-CoV-2 antigen in whole blood for use in serological assay development.
 

Description Product No.
Goat Anti-Human IgG Antibody, HRP conjugate AP112P
Goat Anti-Human IgG Antibody, HRP conjugate AP309P
Anti-human IgM (μ-chain-specific) HRP A6907
Anti-human IgA (α-chain-specific) HRP A0295

For Research Use Only.  Not for Use in Diagnostic Procedures.
 

Probumin
Diagnostic Grade BSA for protease sensitive immunoassays and as a stabilizing agent for protein reagents requiring low IgG levels; may be used for molecular biology applications. Purity is ≥ 98%; typical purity is 100%.
 

Description Pack Size Product No.
Probumin® Bovine Serum Albumin 1kg 820452
Probumin® Bovine Serum Albumin 5kg 820456
Probumin® Bovine Serum Albumin 100g 820451

Intended for Manufacturing and Development. Not for Human or Animal Consumption. Not for use in Diagnostic procedures.
 

ProClin™ 300
Biocide designed specifically for use within Diagnostics manufacturing applications only. An effective, environmentally-friendly alternative to existing diagnostic reagent preservatives. At recommended usage levels, ProClin™ presents no health hazards, toxicological problems or disposal issues.
 

Description Product No.
ProClin™ 300 48912-U

 Virus Characterization

Effective vaccines and therapies start with reliable virus characterization. Reagents and labware relevant for the study of viral attachment and entry, viral genomics, and viral proteomics are collected here to facilitate safe, effective work with viruses and other infectious agents.
 

 Virus Attachment & Entry

Early research into the cellular entry mechanism has shown that SARS-CoV-2 uses the angiotensin converter enzyme II (ACE2) receptor for entry, and the serine protease TMPRSS2 for S protein priming. Find monoclonal and polyclonal antibodies and small molecules specific for relevant viruses and the receptors known to be exploited by them for cellular attachment and entry, including ACE2.

Cell Lines for Virus Propagation

Cell lines used to study SARS CoV viral attachment and propagation include Vero variants, Huh-7D 12 and Caco-2, and are available below.

For information on using cell lines for viral propagation, read about Cell Lines for Virus Culture and Vaccine Production.
 

Description Product No.
Vero C1008 African green monkey kidney Cell LIne, Clone E6 85020206-1VL
Vero C1008 cell line [clone E6, Vero E6] 85020206
VeroCCL81 cell line 84113001
VeroCCL81 cell line (animal-component free) 08011101
16HBE14o- Human Bronchial Epithelial Cell Line SCC150
CACO-2 Human Cell Line 86010202
CACO-2 Cell Line human (intestinal permeability characteristics tested) 09042001
Huh-7D12 Cell Line human (expresses ACE2 receptor) 01042712
293T cell line human 12022001
Human Small Airway Epithelial Cells (HSAEpC) Primary human cells (optimized media also available) C-12642
Huh-7D 12 cell line, human 01042712-1VL
ACE2 Inhibitor, MLN-4760 5306160001
Angiotensin Converting Enzyme-2, ACE2 SAE0064
Anti SARS Antibody S-Specific Clone 154C MAB8783
Anti-ACE2 antibody produced in rabbit, Prestige Antibodies® (Enhanced Validation)
Immunogen: ACE2 PrEST
Applications: WB, IHC
HPA000288
Anti-ACE2 antibody produced in rabbit
Immunogen: Synthetic peptide directed towards the middle region of human ACE2
Applications: IF, IHC, ELISA, WB
SAB3500346
Anti-ACE2 antibody produced in rabbit
Immunogen: Synthetic peptide directed towards the middle region of human ACE2
Applications: WB, IHC
SAB2100025
Anti-ACE2 antibody produced in rabbit
Immunogen: Synthetic peptide directed towards the N-terminus of human ACE2
Applications: IF, IHC, ELISA, WB
SAB3500978
Anti-ACE2 antibody produced in rabbit
Immunogen: Synthetic peptide directed towards the C-terminus of human ACE2
Applications: IF, IHC, ELISA, WB
SAB3500977
Anti-ACE2 antibody, clone 4G5.1 MABN59
ANTI-BAT1(C-TERMINAL) SAB1307254
Anti-CD209 SAB1407409
Anti-SARS Antibody, M Specific MAB8787
Anti-TMPRSS2 antibody produced in rabbit, Prestige Antibodies® HPA035787

 

 Viral Protein Research Tools

Affinity gels and columns, plus ready-to-use buffer for cell lysis provide rapid extraction of viral proteins on accelerated timelines, with accurate results.

Learn how western blot can be used to confirm virus purification.
 

Description Product No.
HIS-Select® Nickel Affinity Gel P6611
Protein A-Sepharose® P3391
RIPA Buffer R0278

 

 Gene Editing

Find reagents here for shRNA or CRISPR approaches for knockdown or knockout of the ACE2 receptor and other genes relevant to SARS-CoV-2, available in plasmid, lentiviral and synthetic formats.

For additional information on viral gene editing, please visit:

shRNA ACE2

CRISPR ordering

 Vaccine Production

Effective quality assurance, constant quality control and accurate results are key to manufacturing safe therapies. Our complete solutions for microbial bioburden, sterility and mycoplasma testing as well as environmental monitoring help you meet the highest quality standards and regulatory demands.
 

 Upstream

Our upstream portfolio includes single-use bioreactors, cell culture media, media supplements, critical raw materials, buffers, mixers and a full range of filtration technologies to prevent microbial contamination and ensure your process meets yield and productivity targets.
 

Description Product No. Process Step
CellPrime® rTrypsin 1.06301.0001 Cell Culture
EX-CELL® MDCK Serum-Free Medium for MDCK Cells 24581C-10L Seed Train
Mobius® Single-Use 3L Bioreactor CR0003L200 Bioreactor
Viresolve Barrier Micro Process Development Kit VBMSPDKNB9 Upstream Virus Filtration
Millipore Express® SHR with prefilter membrane in 25 mm Optiscale® devices SHVEA25NB6 Upstream Sterile Filtration
Millipore Express® SHC membrane in 25 mm Optiscale® devices SHGEA25NB6 Upstream Sterile Filtration

 

 Downstream

From scale-up to full-scale production, we offer a range of filtration technologies, buffers, CIP solutions, stainless and single-use systems, integrated technologies as well as validation services. Coupled with our in-house application experts who have decades of know-how, we can help you tackle any downstream processing challenge.
 

Description Product No. Process Step
Millistak+ Pod Depth Filter, CE50 media series, 0.027 m2 surface area, 1/4 in. Hose Barb connection MCE50027H1 Harvest / Clarification
Millistak+ Depth Filter in µPod format, CE50 media series, 23 cm2 surface area, Luer fitting connection MCE5023CL3 Harvest / Clarification
Optiscale Capsule Polysep II 1.0/0.5 µm 1/4 in. HB/HB SGW6A47HH3 Harvest / Clarification
Millistak+ Depth Filter in µPod format, D0HC media series, 23 cm2 surface area, Luer fitting connection MD0HC23CL3 Harvest / Clarification
Millistak+ HC Pod Depth Filter, D0HC media series, 0.027 m2 surface area, 1/4 in. Hose Barb connection MD0HC027H1 Harvest / Clarification
Pellicon XL Filter Module Durapore 0.45 µm 50c m2 PXHVMPC50 Harvest / Clarification
Polysep™ II 1.0/0.2/0.1 µm SGW1A47HH3 Harvest / Clarification
Milligard® 0.2 µm SW03A47HH3 Harvest / Clarification
Milligard® PES 1.2/0.2 µm nominal SMP2A25NB6 Harvest / Clarification
Triton X-100 1.08643.1000 Virus Inactivation
Benzonase® suitable for biopharmaceutical production EMPROVE® bio 1.01697 Nuclease
Benzonase® suitable for biopharmaceutical production EMPROVE® bio 1.01695 Nuclease
Benzonase® ELISA kit II for the immunological detection of Benzonase® 1.01681 Nuclease
Pellicon XL Ultrafiltration Module Biomax 300 kDa 0.005 m2 PXB300C50 Ultrafiltration / Diafiltration
Pellicon® 2 Mini Ultrafiltration Module Biomax-100 C 0.1 m 2 P2B100C01 Ultrafiltration / Diafiltration
Pellicon® 2 Mini Ultrafiltration Module Biomax-300 C 0.1 m 2 P2B300C01 Ultrafiltration / Diafiltration
MiniChrom Column Eshmuno® Q, 5 ml 1.25074.0001 Capture Chromatography
NatriFlo HD-Q Recon Mini NXF-01 Capture Chromatography
NatriFlo HD-Q Pilot NXF-10 Capture Chromatography
MiniChrom Column Fractogel DEAE (M), 5 ml 1.25079.0001 Polish Chromatography
MiniChrom Column Fractogel TMAE (M), 5 ml 1.25069.0001 Polish Chromatography
Durapore®  0.22 µm membrane in 25 mm Optiscale® devices SVGLA25NB6 Downstream Sterile Filtration
Millipore Express® SHC membrane in 25 mm Optiscale® devices SHGEA25NB6 Downstream Sterile Filtration

 

 Formulation

Our extensive portfolio of process chemicals, excipients and lipids are designed for high-risk applications like vaccine formulation. Our innovative polymers and lipidic drug delivery excipients feature superior characteristics that ease formulation processes, including squalene and customized lipids manufacturing. Much of our process chemicals portfolio falls under our Emprove® Program, which provides comprehensive regulatory documentation to simplify and speed up regulatory filings. Find our biomolecule formulation excipients list by application here.
 

 Biosafety Testing Services

Our previous experience with Zika, SARS, and Ebola equips us to deliver expedited biosafety testing services during the COVID-19 pandemic. Vaccine and therapeutics developers and manufacturers rely upon our scientific expertise, established and validated methods, and experience with regulatory agencies around the world to partner to fast-track therapies.

Learn more about our full offering of BioReliance® ;Biosafety Testing services.

Learn more about our our BioReliance® Product Characterization Services.
 

 Quality Control and Environmental Monitoring

Effective quality assurance, constant quality control and accurate results are key to manufacturing safe therapies. Our complete solutions for microbial detection and sterility assurance help you meet the highest quality standards and regulatory demands.
 

Product Type
Milliflex Oasis® Filtration System Microbial Bioburden
Milliflex® Quantum Rapid Detection Microbial Bioburden
Steritest™ NEO Sterility Testing Solutions
Steritest Media and Rinsing Fluids Sterility Testing Solutions
Steritest™ Symbio Pumps Sterility Testing Solutions
PyroMAT™ System
Pyrogen Testing
Active Air Monitoring- MAS-100® Family/RCS® Series Environmental Monitoring
Air Monitoring Media- Contact Plates, HYCON® Agar Strips, M Air T® Cassettes, Settle Plates Environmental Monitoring
Passive Air Monitoring- ICR and LI Settle Plates Environmental Monitoring
Surface & Personnel Monitoring- Contact Plates, HYCON® Contact Slides, ICR Swabs Environmental Monitoring
Settle Plates for Active and Passive Air Monitoring ICR LI
Environmental Monitoring
Microbial Air Samplers MAS for Isolators in the Pharmaceutical Industry
Environmental Monitoring
Microbial Air Samplers for Isolators in the Pharmaceutical Industry
Environmental Monitoring
Contact Plates for Personnel and Surface Monitoring ICR RT Environmental Monitoring
Media Fill Testing in the Pharmaceutical Industry
Environmental Monitoring
Milli-Q® IQ 7000 Water System Ultrapure Water
BioPak® application pak Ultrapure Water

 

 Development and Manufacturing Services

World-class process development and manufacturing for virus-based therapeutic products. From small scale toxicology and Phase I material to commercial-scale manufacturing and fill finish, our flexible facilities and expert staff are leaders in viral product manufacturing. Learn more

With extensive experience in producing customized cell lines for enhancing viral vaccine production, our cell engineering services enable you to produce higher levels of vaccine titer and scalable production cell lines. We will work with the parental cell line of your choice to generate your desired modifications.

 Therapy Production

Effective quality assurance, constant quality control and accurate results are key to manufacturing safe therapies. Our complete solutions for microbial bioburden, sterility and mycoplasma testing as well as environmental monitoring help you meet the highest quality standards and regulatory demands.
 

 Small Molecule Therapeutics

Classical Pharmaceutical Formulation & Manufacturing

Finding a robust formulation, complying with regulatory requirements, and adhering to quality standards are all top priorities when manufacturing an anti-viral or other small molecule drug.

Based on our expertise in this industry, we understand your challenges in development and manufacturing of small molecule pharmaceuticals and formulation and can support you with products and services. Click here to find out more about our portfolio and access relevant technical resources.

Comprehensive End to End Solutions for Genotoxicity Assessment

BioReliance® offers genetic toxicology services for the detection of toxic, mutagenic, clastogenic and morphological transforming activity in a number of well-characterized test systems. Our scientific staff and state-of-the-art facilities provide the most current and comprehensive genetic toxicology resources available anywhere.

 Plasma-Derived Therapies

Plasma manufacturers are investigating plasma therapies as a treatment for COVID-19. Plasma production processes are highly variable depending on the production platform utilized. Please visit our Plasma Resource Center for information on common challenges in manufacturing plasma-derived therapies and how we can help you overcome them.

Please see our brochure for an overview of the products and services we have to support plasma-derived therapy manufacturing.

Relevant chromatography and TFF products for plasma can be found below.
 

Description Product No.
ESHMUNO P anti-A 1.20094
ESHMUNO P anti-B 1.20095
Fractogel EMD TMAE (M) 1.16881
Fractogel EMD TMAE (S) 1.16887
Fractogel EMD TMAE Hicap (M) 1.10316
Fractogel EMD TMAE Medcap (M) 1.16885
Pellicon 3 Cassettes
 
Viresolve® Pro Solution VPMNVALNB9
Viresolve®  Pro Micro Shield kit VPMSKITNB9
Viresolve®  Pro Micro Shield H kit VPMHKITNB9

 

 Monoclonal Antibodies – CDMO Services

BioReliance® End-to-End Solutions
Your biotech company has discovered a promising molecule with the potential to develop a biologics drug against COVID-19? If you don’t have the in-house resources and capacity, we can develop and manufacture your treatment for you; offering a flexible model for engagement that can include fast-track development and no upfront payment or booking fees. Our adaptive CDMO solutions allow you to more effectively manage project risks and manage uncertainty, guiding you from cell line development and process development to GMP manufacturing.

Explore our end-to-end MaB manufactring portfolio.
 

 Monoclonal Antibodies – Products and Testing Services

From upstream to downstream, single-use or stainless steel, traditional or intensified processing, we have the full portfolio of chemicals, systems, consumables and characterization and testing services to help you produce your monoclonal antibody.

Explore our portfolio for every step of your mAb manufacturing.
 

 Quality Control and Environmental Monitoring

Effective quality assurance, constant quality control and accurate results are key to manufacturing safe therapies. Our complete solutions for microbial detection and sterility assurance help you meet the highest quality standards and regulatory demands.
 

Product Type
Milliflex Oasis® Filtration System Microbial Bioburden
Milliflex® Quantum Rapid Detection Microbial Bioburden
Steritest™ NEO Sterility Testing Solutions
Steritest Media and Rinsing Fluids Sterility Testing Solutions
Steritest™ Symbio Pumps Sterility Testing Solutions
PyroMAT™ System Pyrogen Testing
Active Air Monitoring- MAS-100® Family Environmental Monitoring for Microbiology
Air Monitoring Media- HYCON® Agar Strips, Settle Plates Environmental Monitoring for Microbiology
Passive Air Monitoring- ICR and LI Settle Plates Environmental Monitoring for Microbiology
Surface & Personnel Monitoring- Contact Plates, HYCON® Contact Slides, ICR Swabs Environmental Monitoring for Microbiology
Settle Plates for Active and Passive Air Monitoring ICR LI Environmental Monitoring for Microbiology
Microbial Air Samplers MAS for Isolators in the Pharmaceutical Industry Environmental Monitoring for Microbiology
Microbial Air Samplers for Isolators in the Pharmaceutical Industry Environmental Monitoring for Microbiology
Contact Plates for Personnel and Surface Monitoring ICR RT Environmental Monitoring for Microbiology
Media Fill Testing in the Pharmaceutical Industry Environmental Monitoring
Milli-Q® IQ 7000 Water System
Ultrapure Water
BioPak® application pak Ultrapure Water

 

 Personal Protective Equipment

Personal protective equipment (PPE) is critical for your safety when working in the laboratory. PPE such as gloves, safety glasses, and lab coats supplements your laboratory’s established experimental protocols. Please refer to local regulations for eye protection guidelines.

Dermatril™ nitrile, powder-free gloves provide exceptional protection against chemical and microbial contamination, plus superior durability compared to conventional disposable gloves. Microgard™ 2500 material is extensively tested in accordance with statutory requirements, including physical performance attributes and barrier to hazardous infective agents.
 

Description Product No.
Dermatril™ nitrile gloves, size M Z677272
Dermatril™ nitrile gloves, size L Z677280
Dermatril™ LR nitrile gloves, size M, extended cuff Z677329
Dermatril™ LR nitrile gloves, size L, extended cuff Z677337
Dermatril™ P nitrile gloves, size M, extended cuff Z677388
Dermatril™ P nitrile gloves, size L, extended cuff Z677396
Microgard™ 2500 lab coat size M Z679224
Microgard™ 2500 lab coat size L Z679232
Laboratory Protective Eyewear
 

 

 ATP Testing & Sanitation

Recent studies of the NIH showed that viable viruses can be detected after 2-3 days. The MVP Icon® is a quick and easy-to-use system to check effectiveness of cleaning and disinfection procedures, even if viruses like SARS-CoV-2 are not directly measured. The MVP ICON® measures the amount of adenosine triphosphate (ATP) in surface samples, an indicator of environmental contamination. Results are obtained in less than a minute and securely documented for subsequent evaluation. The MVP Icon® helps you and your staff in a fast and easy way to monitor the success of cleaning and disinfection procedures.
 

Description
Product No.
MVP Icon® 78300BC
MVP Surface Sampling Device 64003-100